Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672517
Length 713 bp
Fasta Format > whms10d18
gtcagacagacagggggcgactgctctgcctgcaaaggagtcgtctttct tcccctgctccgccgccggcgccggcgatggcgcgcaacccctgcgacat ccgcctcctcctcgtggccgccgccttcgccttcatctacatccaagtgc ggctcttctccacccagtcgtcttcttctaattcccaggcgatggacggc ggacgcctcgcggaagcagagaaatgcgagagccagctgcacgccatgat cgaccaggtcagcgcccagcaggagaaaatcgccgcgcttgaagagatga aggtacgccaagacgaggagcgtgtgcagctcaagattttaatccaagat cttgaaaaaaggagcttacagaccttaataaacaagaacgtggttcctgt cgccgctgttgtcataatggcttgcaatcgaccagactatttgcagagga cagtggaatctatcctcaagtaccagaaagcagttgcttcaaagtttcca ctatttatatcacaggatggaacaaatggagaagtaaaaaagaaagcttt gagttacaatcaaataacatttatgcagcatgtggatcttgagcctgtgc gcactgaaagaccaggagaaaacgttgcatattacaagatagctaaccac tataaatgggccttggatgagctcttcattaagcatgatttccgccgagt aatcattctggna
Download
page-top