Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672516
Length 712 bp
Fasta Format > whms10d16
ggagatcaccgagcccagcgcgcgcacaggacagcaggcgccgcgatctc gcacaggagcggagatggggctcacgttcacgaagctgttcagccggctc ttcgccaagaaggagatgaggatcctcatggtcggtctcgatgcggctgg taagaccaccatcctctacaagctcaagctcggagagatcgtcaccacca tccccacaatcgggtttaatgtcgaaactgtagagtacaagaacattagt ttcaccgtttgggatgtcgggggtcaggacaagatcaggcccctgtggag gcactacttccagaacacccagggtctcatttttgtcgtggacagcaatg acagagagcgtgttgttgaggcaagagatgagcttcaccggatgctgaat gaggatgagctgcgtgatgctgtgctgctggtgtttgcaaacaagcaaga tcttcctaatgccatgaacgctgctgaaatcactgacaagcttggcctgc attctctgcgccagcgacactggtacatccagagcacatgtgctacctct ggagaggggttgtacgaggggcttgactggctgtccaacaacattgccaa caaggcttgaagcatctcggcaggggcttctatggatctggataagctgg atattcggactaatactgcctttacgtattataaactatatagtcttgac agataatgtggg
Download
page-top