Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672503
Length 653 bp
Fasta Format > whms10c18
cgcgagcccaaggaggagaacgtgacgctcggccccgccgtccgcgaggg ggagcacgtcttcggcgtcgcgcacatcttcgcctccttcaacgacacct tcatccatgtcacggatctgtccgggagggagacgctcgtccgcatcacc ggtggcatgaaggtgaaagctgatcgtgatgaatcatccccttatgcagc tatgcttgcatctcaggatgttgctgtaagatgcaaggagcttggaatta ctgctctgcacattaagctccgtgctactggtggaaacaagacaaaaact ccaggtcctggtgctcaagctgcgcttagagctcttgcacgttctggcat gaagattggacgcattgaggatgttaccccggttccaactgacagcactc gccggaagggtggtagaagaggaaggaggctgtaattccatgctcgttca aggatggaacaataccaagctatcgatatcctgtgtcttgcaacttgttc tgtactactccgtttatgatgttactccgtttatgatgttaagtcagatc ttgtggatttatagattttgagcgatattgtgttgcatgtttagaaaatg acccttttccctgctttgaatcaagtggttgccatctattattaaaaaaa aaa
Download
page-top