Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672498
Length 747 bp
Fasta Format > whms10c07
gcgcacggttgcgaaacaagtggattatttagaagcaagaaggaacacct gaagccatgtgtatcgctgcatggatttggcaggctcacccacagcatca gctcctgcttctgctcaacagagatgagttccatagcaggcctacaaagg cagtaggatggtggggggagggctcaatgaagattcttggtggcagggat gtacttggtggaggaacatggatggggagcaccaaagatggcagacttgc cttcctgaccaatgtgctcgagcctgatgcgatgcctggcgcacgcacta ggggagacctgcccctcaggttcctgcagggcaacaagagcccgctggag gttgcaactgaagtggcaaaagaagctgatgagtacaatggcttcaacct tatactagctgatctaaccaggaatgtcatggtttatgtgtcaaaccggc caaaggggcagcctgcgacgattcagctcgtctcaccaggactccatgtg ttgtccaatgcaaggctagacagcccttggcagaaggcaattcgccttgg taaaaacttcagggagtttataaggaagcatggtgatgatgaagttgaag cgaaggatatagctgacagactaatgactgacacgacgagggccgataaa gataggctgccaaacaccggttgtgatcccaactgggagcacggtctgag ctccatcttcatcnangtgcaaactgacnaanggctctatgggacaa
Download
page-top