Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672496
Length 711 bp
Fasta Format > whms10c05
ctcctctcccttgttgctacgagtagtacgcttggtggtggtggtggtgt gtgtgtatggttgctgcagcatagctagctagggacggggaaggtggagg aagcagcggagtcagccatggggagggggagggtggagctgaagcggatc nagaacaagatcaaccgccaggtcaccttcgccaagcgcaggaacngcct gctcaagaaggcctacgagctctccgtgctgtgcgacgccgaggtcgcgc tcatcgtcttctccaaccgcggcaagctctacgagttctgcagcacccag agcatgacgaanacactcgacaagtatcaaaaatgcanttatgcaggacc tgaaactactgtgcagaacagagaaaatgagcaactgaaaaacagccgca atgagtacctgaaactaaaggcacgggttgataatttacagcgaacacaa aggaatttgcttggtgaagatcttgattccttaggcataaaagagctcga gagccttgagaagcaactcgattcgtccttgaagcacattcgaacaacaa ggacacaacatatggttgaccaattgacagaactccanagaagggaacaa atgttttcanaggcgaataaatgtcttcgaataaaaattggaggagagca accaggttcatgggcagcagctctgggagcacaacaacaatgtactgagc tatgaacgtca
Download
page-top