Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672495
Length 654 bp
Fasta Format > whms10c03
taattcgcaccggcacacaggagcggcagtaatggccgcgtggtgccggt gccagtgccagtagcacgcaggcaggcaggggagcagcgccactgcactg ggcactggtgacgcttcgagcccactcgccacacccttccctccctccct cgctcccttcgcctcctcaagccgggctcccaatctcgcgaagcggcggc cctcattggccggcggcggtgcgcggccccggtcgtttcctccggcgtca ggtgcccgtgatctggttgttgcagaggcggcgaggtgaggtgacgcggc ggcgcgatgaggtggctcaagtcgtttgttgggctgaggaaggtggagag gcagcagcatcagcagcgccgcaaggaggatggcgacgccggccgaacaa aaagggatgccgtcgatcagttccacttccaggatcagcactcccaggat cacgctagccttgtcggaccagaagagttccctgatggaaatgttccgtc agaagacgattgcagcacaccttcatgctcaggacctggtttcagtacac ttancgtgccactgcctcaaacagaanaggagctcaaagagatctgggct gccacaattattcanactgcgtatanagccctactggctangagancccg ccna
Download
page-top