Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672493
Length 759 bp
Fasta Format > whms10c01
gcagcgcagcaaccaacctcgaaatccaagatctacgtcgacagcagagg aaccatcaatcaagaagaggccatggccggcaaggaggaggcggggaagt tgatggtgagtccgggcagcgctgccaattcgacggaggccagcgtcgat ggtcctgcggcggtgttcccctccgccgccggatccatctacaaggaggg tgacgagtctttcgagtcagacaagggggtgactgcgatggacaagatgc ttggggaggcgaatctgtcatccgccgtcgccaatcagccggccgcagca ccaccaggtccaaacaagggcaaggttcggctgtcgaaagccgagattag gaccataattgcgctgaagccggagcaacaccccagcgccgattacctgg acgatctggcagagtattttcctctggagtggattgaggaaaggaagcgt gcccacgctgacagtgtagagcttttcaagaagatggacgacgatttcna agagtaccggcaggaggtcatcgcgtctgtgcgggacaagggctactacg aggtcgatgaanaactcatcgccaacagggaaagggggaacgaaaacgct gccgaacaatggaanaanattgattggactggaatacanattgctatccc ggaggacaggctgagggattctgatanctatcgtccatacnttcctgacc aanatgatgctcttgttgaanctcttgtgatcnantgattctcaaanata ntctacttg
Download
page-top