Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672492
Length 559 bp
Fasta Format > whms10b23
gcctcctcctgtctcgccctcgccccccgtcccctcgtcggcgcccgatc taagtcaagatgagtcgtggcgggagtgctggtggtggtcaaagttctct gggttacctgtttggagatggtgagcctgcaaagcccgctgcagcaccag ctgcgaagcccgcacctgctgagaaaccagcaccggcagctgctgatgta gccaagcagattccagctggcattccaggtagccgggcgaacaactacta ccgtgcagatggccagaacacgggcaacttccttacggaccgtccttcaa ccaaggttcatgctgctcctggcggtggctcctccctgggctacttgttt ggcggaaagtgatgttaatgatgctgcttaatgaacgaacgatgaattgg cctgtatctctgttatccatgtggtgaaaactggaagtgtttggtttcag cagtttaccacctgcgtcgatgtactctgtctgtatggttcattgtgtcc aggctgacctcctgcttggaagccagcttgcctaaaacctgtcgctttca aaaaaaaaa
Download
page-top