Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672491
Length 507 bp
Fasta Format > whms10b22
agtcacctcaccgaggagaagcagagagaagggagaagatgtcggggcgc ggcaagggaggcaaggggctcggcaagggcggcgccaagcgccatcggaa ggtgctccgggacaacatccagggcatcaccaagccggcgattcgacgtc tggcacgtcggggcggcgtgaagcgcatctcggggctcatctacgaggag acccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgacgccgt cacctacaccgagcacgcccgccgcaagactgtcactgccatggacgtcg tctacgcactcaagcgccagggacgcaccctctatggattcggaggctag gctccggcgaggcgaatccagctcgcacctgctgatcagatattcagatt agcagtagctaggcgttgttcagtgttcatggtgatcgatgtaatttatg atgtatggtgcctgttcgttggaatggataaatcgctgttatttaccaaa aaaaaaa
Download
page-top