Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672486
Length 546 bp
Fasta Format > whms10b17
ctcgcatccattctcaaggttagcaggagaccggccatggcgccgttgca gcccaagtcagggctcttcgtcggcatcaacaagggccacgtcgtcacca agcgcgagctgccgcctcgcccgtccgaccgcaaggggaaaggtaccaag agggtgctgtttgtcaggaacttgattagggaggtcgctggatttgctcc ctatgagaagcgtatcactgagcttcttaaggttggaaaggacaagcgcg cactcaaggtcgccaagaggaagcttggtactcacaagagagcaaagaag aagagggaggagatgtcaagtgtcctcaggaagatgaggtctggtggtgg tggtgctacggacaagaagaaatagattttgcatgttgatttatctcaat gctttgccctgtatttccacattatgccaagtttgtagcctgtggcaatt ggagacgaatgtagtacattgcacttcaagttcagagtcaaactatgaat ttttgacactatttgcaattggagtgacatggtagtaaaaaaaaaa
Download
page-top