Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672485
Length 709 bp
Fasta Format > whms10b12
gctagcagcttaaggaacttccagctagcgatcgatggctcgtctcaaca gcaaggctgtggtgtccgccgtggtcctggcggcggtggtgctaatgatg gccggcagggaggcgacggcactgtcgtgcgggcaggtggactccaagct cgcgccgtgcgtgtcgtacgtgacggggaaggcgccctcgatcagcaagg agtgctgctccggtgtgcaggggctgaacggcctggcccgcagcagcccg gaccgcaagatagcgtgcaggtgcctcaagagcctcgccaccagcatcaa gtccatcaacatggacaaggtctccggcgtgcccggcaagtgcggcgtca gcgtgcccttccccatcagcatgtccaccaactgcaacaatgtcaactag ttcaatatataacccttccgacgtgcatgcaaggacgcgcttgtgtggag cttaatgtctacgttgatggagtgctcatacgatactgagctactaaata ataaaatgaagttgcttgcgtgtgttatttcagtactgtgtcactgtgtg tctgtgtccatgtctgtaccttgcgcacacactgtgtgtgcatatatatt tatgcgacatgtatgcatgcgtccgtatgcgtgagtgaactgtcaactct ttgctgtactctantgtanccgatgtgtacntgtgatgtgcctgacctac ttgttcang
Download
page-top