Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672473
Length 514 bp
Fasta Format > whms10a17
ctgcggaggntaactgcgggtgcggatccggctgcaagtgcggcaacgag ctgcggagggtgcaagatgtaccctgagatggacgagggggtgaccacca cctcccagaccctcatcatgggcgtcnccccctccaagggcaccccgtcg ttcnangccgccgccgagaccggagccgacaacggcgggtgcaagtgcgg ctccaactgcacctgcaacccgtgcacctgcaagtgatccatcaaatcag gacaaggagatggcatggcatggatggacctaatgaaggagcactagtag tagttatgcatggtgtgtgcgtttgtgttctctttttaattgccgccgag aataagacgagatctatcgtatcgtatcntatcntatcgagctagttcat ggccccttgtggcttgtaccgtgtggtgtgcaaggcgcgcgtacgtcctg tgtctgtgacgcgccttttcctactgttctaagctccgtcccgtgccttc ccgttttatctaca
Download
page-top