Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672469
Length 703 bp
Fasta Format > whms10a09
catgccccagccgccatagtggagccctacgccgccgccgagatcggaga ggagccgccgctgccgaggttcgagaggagctggccaccacgacctccct ccccaggcggccgccaccaccccctccccaagcagccatgtacagcaggg cggcgcccacgcgcctggcctatgtaggtctcggcctccctcctcccttc gtccaaggccaggagctccccctccccgacccgatctggtggagagaggg ccaggccttgccactccggtggtcgctatggccagatctgtccggggtag tcgccgtagagcctctatggcggcggagtagcagcagcccgacagaaggt gggtgccagatcgtcgtccagcagctcgccgtcggagcttctcactacag gcgatggaggtagggatgatgctgcggatgggatgggaagatgtgtgtgt gtgctagctgcttcacatacgactcagagaaagaattgctttgcagtttc aggttgccaacatcacgaatttcatacttatggagtggagccaccaaaca atttatgagatttccgccatggacgccgcctcgctcatgggctcctcctc caccgacgcacgcaccgacggggagcaccggatgggcatcaccatcatgg gcgtctgctacgacggcggcgtcctcgccgctgacactcangaccagcac cga
Download
page-top