Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672463
Length 614 bp
Fasta Format > whms10a03
cagagcagagcggataaactcgagggcagtagatcatcaccaaccatgtc gtgctgcggaggcaactgcgggtgcggatccggctgcaagtgcggcaacg gctgcggagggtgcaagatgtaccctgagatggacgagggggtgaccacc acctcccagaccctcatcatgggcgtcgccccctccaagggcaccccgtc gttcgaggccgccgccgagaccggagccgacaacggcgggtgcaagtgcg gctccaactgcacctgcaacccgtgcacctgcaagtgatccatcaaatca ggacaaggagatggcatggcatggatggacctaatgaaggagcactagta gtagttatgcatggtgtgtgcgtttgtgttctctttttaattgccgccga gaataagacgagatctatcgtatcgtatcgtatcgtatcgagctagttca tggccccttgtggcttgtaccgtgtggtgtgcaaggcgcgcgtacgtcct gtgtctgtgacgcgccttttcctactgttctaagctccgtcccgtgcctt cccgttttatctacatatatgtagacaacaataatttggagtttctctct atgtaaaaaaaaaa
Download
page-top