Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672462
Length 703 bp
Fasta Format > whms10a02
cccatcatcgcctcggcggccgcacaaccgacctcctcgaagccccgatc tccttcacctctcctctccgtgccagatcgttgtttatgagctcgaagga gaagcccaccctcggaggccagcggattaagacccgcaagcggaatatcg cagctcctttggacccttcgtcgttctctgatgcaattgtccagatttat ctggataatgctggagacctggaacttgttgccaaaagtatagagtcatc agatctcaacttctcacgttacggtgacactttctttgaggttgttttca ttggtgtgcgtactcagcctggtacgattaaacccgaagaagagggagag cgccacccctattctctcattgactgtgcagcacaacgtgaagcaatatt accttatgtcctctttattcagaaaacattgcgcaggaggcctttcttaa taaagagtcttgaaaatgttatgcgaaaatttctccagtctttggagttc tttgaagaaaatgagagacagaaacttgccattttcacggcacttgcatt ttctcagaaattatcaggtctgccacctgaaactgtctttcagccattgc ttaaggacaatcttgttgccaaagggatagtgctttcattcattactgag ttcttcaaggaatatctgaaggaaaatagtttggatgatctgattgcact ttt
Download
page-top