Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ563148
Length 304 bp
Fasta Format > rwhkv20n21
catctaaagatggtgctccttacaaagtttcaacacaacggataacaagc atacacgcagagaggtgggctatgcatagattttctgtatactcagagcg cgcaagctggtaacgcctgctagcgctagcacacaactaaatatactgca ccaccaatatatagctgctttgcatgtacactctgatatggagctggcag ttgctcanaaaccatgaatcttgatgtgttccttcttcacaatgccggcc tggacaaggaagtttgagacgttcttcctctgatcaccctggagttgaat gacc
Download
page-top