Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ562039
Length 861 bp
Fasta Format > rwhkv17n16
tgtgcaggagctccgtggtaggccaacatgctaataccttgtacctacgt gagaatacacccgagaaggacaccactcactatgtttcgtcgagctttgg ttcaaggaccacagcgatcttctccttcttatctccgcgcaatacttcca cggtcaccgtctctccgactttgcactgatccaagatacggtacaggtcg cttccattcgcaaccttagtaccattaacagaagtaattatgtccccgag gataagtcgtccgtaggcatcccgtttcgttgattgcagacccgctttgc cagctggcccgttcgggggggcatccaagacaagcactccactcaatcca agctgctccacagattggtcaggggcaaattttatccccaaaataggtct cgtcactttcccaaattgtataagctgatccacaataccaccaactgtat caactggaatggagaagccaaccccggatgatgctcctgaaggtgagtat atagcagtatttacacctatcaggtttccagaactatcaagaagtgggcc tccgctgttaccagggttgatagcagcatcagtctgtattacatcctgta taggacgtccagttgcagctgaactaatttctcgtcgcagtccactgata acacctgttgtaagagtgtggtcaaggccaaatgggttcccaatggcata cactttctgaccaaccagtaagtccgctgacacaccaactggtaaaggtc ttagtttatcctttggtgcttcgatactcaaaaccgcaacatccttgtcc tggtcaaatccgacaacttgcgcttcatacaccgactgatcagcaagcgt gaccctgaggt
Download
page-top