Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ561885
Length 878 bp
Fasta Format > rwhkv17f22
aaactttccatgacctctcctcatggtttttatccatggttttttggcag aaaggaaattaaagattgttcagcgggcttcttcctaacccacaagacaa aataaaacagagtgtcgttctcttgtaaaggtaagcttttatttcaagac cacatcgaagaagcagacatgagggaaccttcagcggctcagccactgca ctctggtgttgatttagatccgaaggcggttagatgtcaaagggtagtct caagaatgcctccatttgcttcgccctagtcttgatcgacatgtcaaaca ccttctgcccaaattcaatcaccagtcctcccatgatactctggtcaatc ttttgttcaaccaagatggttttgtctttcccaaggatatcacgcaaggt ctccttaagttctttctcctccttatcaggaagtggaacaacagtcctga caacaactttcacctcccccctatgtgccatggtcaaatcaacaaatctc tcagcaatgcgctcaacatatttcagtcttccattggatgccagtgcaga caagaatttctttgtgatgtcagtaaacccggcttcagagaatatttcag ttatagccttcaccctggtttctttaggcactgatgtgtccttcatgaat tgagaaaacatagggctcttcttggatgcccctacaacatcgagaatctc ggattcaactttttccaacgaatttgcgttggctgctgcaaggaacaacg cactagcatagttgccggtgccaccatacagagcttttggaaccttgatc ttgttctccttaggcttatccgcctccgttgccagccccctcgatacctg agcgacggccgcggaattcnttggccgc
Download
page-top