Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ561632
Length 891 bp
Fasta Format > rwhkv16h05
ccagacatcaaaacatagttcccagtatcacgacaaggtaggtcataaca gcaagactcatcgatacaaaatagtgcagctctctttaacaacacaagac caggtaagggataacagcaccaaaaatttagagcttgtcctcgaaatcgg atagaggggtcatctgctccttgaggcccttcctcttgcggatatccgtg acgagcgtcgccgactgggtgcctgggtccaaaggatcagaagccatgat gtcccagtggtcaaacacacactgggggaaggcctggccggacgtcgcgg ccctcagggtgcttgagaacccaaaggattcaatgacggggaggtaggcc ttgatgttgtagagcggggtaccttgcctctgcatctcctcgaacacgtg ccctctcttctgattcagaacaccatagataccaccaagcgcattctccg gggcctggatctcaaccaggtacacaggctccagcagccttggcttggca gtcagctgagaagcataaatgaccctcctggccgtgggaatgacctgacc accacccctgtggatagcatcagtgtggagaacaacatcacagacctcaa agcaaatgccacgcatgttctcctcagccaacgcgccttcctttgacgcc cactggaaaccagccacaacagagtccttgatttcattaagatactgcac tcccttacacatgtcgacgaccatgttggggccagtcgtctcaggtccaa agcaccaaatcttcttggcaagatccttgtcccacccaaactcctcanac aggatcttggaccgcaccttaggatcatcacgtgggccaatgcgaccatc atcaatggcctcanccagtccctcctccaaggggcgagctt
Download
page-top