Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ561537
Length 807 bp
Fasta Format > rwhkv16b20
cgcgtacaaatttacattttacacccaccctcgcatatatacctctcgca cgctcacgtttcccacgacgacgggtaccatgcacaggacgacgatgctc ggatcggatcggatcgatttcgcctagtggaacttgaggctggtgaggat gttgttgttgacggggtctgagaggtggtcgaggaggttctggaagggcc cgacgccggtgaagatggcctgcagggacatgccgaggaaggcgagcatg gcgaggcggccgttcttgatctccttgagcttgagctccttcatctcctt ctcgctcttggtcccgaacccgagcgggttgaagatgggcccgccggggt aggcggggtcgccggagccgccgaggtacttctcaaggcccaggaagtac tgcttccccatggagcccgggttgtaccagtcctggagccgccggtgctc cgcgaagccgatgagcgccatctcgaacacgaagagcgtgtatgggtcgg cccagtactggtaggtgcccgccggcgggatcgcgcctgcctggaaccac gggatcgccgtctccgggggcaccangcccaccttgcccanggcctccgg ggcgatcatgcccaccacccccatcatcnccntccngccgttnaanatct cnccntangccanccacctggnctcnatgaacccnccngtgccctccngn tcnnacanccccaangngtcnaaaccanantcancnnncancntnccnnc nangnannnnangnactgcttnnanncnaancnnanntnnntnntnnnnt tttnctt
Download
page-top