Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ561114
Length 492 bp
Fasta Format > rwhkv14i13
tatttattgatgattacactagtcaatatacggccggggttaacaaaaga gatattaccagatacaaaactcaacaaatacactgcccatagatagcaga atcgaaggattcaagcaggatcatacacacacacccatactagctaccac tagctagcttcatatcaatttggtatagctagctactagtagttacacga cactgaagactcgcaccatgctatgatcgtcaccggtactcacaggagag agatcatcacgctccccgatcgagaagttacaattgccaaaggatagaag ttgccctaccttagtagaggtgagaagtcgccgccgccgccgtggacgag gccgccctgccggccagccatggccgtttcaccccgagcttcctcaagaa cccaagtagcctagccagctgcagcttgatgtaggccagagatagctagc caacgccggatccatcggctgctacgtacgcgcggcacgagg
Download
page-top