Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560916
Length 866 bp
Fasta Format > rwhkv13n11
atatacttagacgtgagacatcataacccttgatccactaccacgaatgt tgcaactcgcacggaataactccgaccactcggaagcaaaacaataacca ccacaacctcaagtctcagataacacagacacggtataataagcagcagg cttcgccgcctctgcaacagaacaactgactgtttagtcgacctcctcga tcttggggccagggccgccggatgcagctggggtgtcgtcgtccatgccg ccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggtt gcacagggcctccagctccttcatcttgtcctcgaactcatccgcctcag cgagctggttcgtgtccagccattggatggcagcatcgatggcatcctcg atcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtcctt gatggtattgcgcatgttgtacgagtagttctccagggcattcttggact ccgccttcttcttgtgctcctcgtcctccgacttgtacttctcagcctcc tggaccatcttctcgatctcctccttgctcagcctgcccttgtcattggt gatggtgatcttgttcttctgcccagtcgtcttgtcctcagcagacacgt tcaggataccattggcatcgatgtcaaagcagaccgtgatctggggaact cccctgggtgcgggagggatgccagacagctcgaacttgccaaggaggtt gttgtcacgggtccttgtcctctcaccctcgtacacctggatgagcacac caggctggttgtccgantangtggagaanacctgctccttcttggtgggg atgggtggtgttcctt
Download
page-top