Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560904
Length 370 bp
Fasta Format > rwhkv13m20
cttagacgtgagacatcataacccttgatccactaccacgaatgttgcaa ctcgcacggaataactccgaccactcggaagcaaaacaataaccaccaca acctcaagtctcagataacacagacacggtataataagcagcaggcttcg ccgcctctgcaacagaacaactgactgtttagtcgacctcctcgatcttg gggccagggccgccggatgcagctggggtgtcgtcgtccatgccgccctc catgtcggcaccagcaccctggtacatcttggcgatgatggggttgcaca gggcctccagctccttcatcttgtcctcgaactcatccgcctcagcgagc tggttcgtgtccagccattg
Download
page-top