Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560837
Length 797 bp
Fasta Format > rwhkv13i24
tacacaaaatcatatagaacaaaaggtatgctccggtcagaaagcagagt cgtacagcagagttttggacaaaagtgaagttcacaaaagaccttcatac gagataggccattgtttcaactcgtagtttaggccttgccggactcctcg caacccggtggcctaaaggcgatgaagctgacgcactgcacctggcgcag gttgtcgaagccgatgacacggacataggcgtcagggtactccttcttga cctcctccacctcgttcagcacctgtgtggcgtcagtgcacccgaacata ggcagcttccacattgtccagtatcggccgtcgtagtacccgggggagct gttgtgctcacggaagacgaagccaaccttgctgaactcgaggcagggca cccactttgagcggatcaggtagtcgacctgtttcaggagggcctccgtg gataggggtggcaggtaagacagggtctcgaacttcttgatgccctcaat tggccacacctgcatgcacctgatccttccgccattgctgacgctgctga ggctgccgctggagcggcggccgacggggagaccggctgtggacttgagc ccctggaagggtgcgacggtggtagccgaggaagccatcacggcgggggc catggtaatgtattatctggaggagaggaggatgccctcgtgccgaattc ngcacgagggagagacgtgtcacaaaaatacaaatangttggcataacnc ataacangcanctgtanggacatactttcaagtttcnaanatcctaa
Download
page-top