Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560821
Length 813 bp
Fasta Format > rwhkv13i03
agataaacatccacattacatctagaggcaaccacgagttcgcaaatcaa caaacatcaggcaaaacttaaaaacgatggttccaggaacatagttctat atccttgcagataactggctatagcaaaacgactcaacgcctcagaatca ggccttggcagcagcctgggcagcggcatcccgcttcctctgctcctcaa tgatggtgagcttgatacccttgcccttggggaggctcacccatggcttg gtgcccttgccaatggtgaatacattgcccagacgggtggcgaactggtg gccctgggcatcctcaacgtggatggtctcgaaggttcccttatgcttct ccctgttcttgatcacaccaacacgcccagtgttgcgcccgccagtcacc atgaccacgttaccaacgtcgaacttgatgaagtcaacaatcttgttggt ctccaggtcgagcttgatagtgtcattggccttgatgagagggtctgggt agcggatggtgcggccatcataggtgttcaggtaggggatgcccttctgg ccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatc cctgacagagtgaaggcggaagcggcccttggtgtcatacagaagcctgt agttctcaccagtcttgggaatggaaatgatgtccatgaaaccagcaggg taggtcttgtcagtgcggacctttccatcaaccatgatatgacgctgcat aaggatanactgcacttcacggtaggtganagcatatttcantctgttcc tcangatgaggat
Download
page-top