Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560710
Length 843 bp
Fasta Format > rwhkv13b20
cactcgacgtatttacaagtacaaaaggggatcaagatggccagcagata gaatcggatctctcttgtagagggagatttccttatatctaccctaaaca gcaatcacatgcgtacaagcttaaatatgcagtgatacaagcaaacacag gcccaaacttattgcccaattcatatttacaaggcactagagaaaagaaa ttatatgtgggctcagaaacttttggtgctttcacctccatcttgtctaa ataaaaaatctggacataacttttctaccctctgctagtcattcctggag tttgtacggagcaagtcactcggaaaccccatccttcagcttatttcaga ctcatactgatgtcgaccaagaaggtgatggaactacaaaaattgtttcc aatgcataataccacatcgtgagcgcgagcagaccatacttacaatccta tacttgatctgagcaggtagtttgtgcattggcgacaaccttgctcacat tggaagacagctttcctcttagctcagcacagacaagatgtgtcaagagg agcccagcaagaagtgctgctgccatcaacatcgtgaacacggcactcca gctctctgttgagatgtatcctgtgagcaatggcccgatcgcagcaccaa ccgacccggtcccatcgatgattgctgtcacagtggccagtgcccgagaa ttaccattcaatgagctgtgagtgccaaggtcagctgacactgcggttgt gatcagggcataaggaccattgacaaacatgccagtgatgaacatgaggc aaaatgttcgacatcatcgacatgcttccatatgttctgtaca
Download
page-top