Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560320
Length 659 bp
Fasta Format > rwhkv11k22
atatacggccggggttaacaaaagagatattaccagatacaaaactcaac aaatacactgcccatagatagcagaatcgaaggattcaagcaggatcata cacacacacccatactagctaccactagctagcttcatatcaatttggta tagctagctactagtagttacacgacactgaagactcgcaccatgctatg atcgtcaccggtactcacaggagagagatcatcacgctccccgatcgaga agttacaattgccaaaggatagaagttgccctaccttagtagaggtgaga agtcgccgccgccgccgtggacgaggccgccctgccggccagccatggcc gtttcaccccgagcttcctcaagaacccaagtagcctagccagctgcagc ttgatgtaggccagagatagctagccaacgccggatccatcggctgctac gtacgcgcccatgggccatggccggcccagggcacactccaagcctccaa ttgaagaagagcacaggcatgcagctggtactggtagcttatgccaccac catgacataagctatctgagatcttgtggcctacatggtgtgcgctgcgt gcacggacgccggattggataacggagtgtgccctgcccggccctgccgg ccgtacgtg
Download
page-top