Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560257
Length 466 bp
Fasta Format > rwhkv11h04
accttattacaatgaggtacnatacatacagacgtacaatacagctaagg aaggaggtcctccagagccttgtgtgagctatgctcattctggatggcat tgcggcaggtgaggtgatcggctatcacacatactancagaaagcgtcat agttatttatcccactgatcggctatctcgatacggtcnatgattagccg tgtangtggtaatcgtcgagtgcanaacgacgacgaacccgggcgcgggt tctacatgcagaacggctcgcggtggatgtcaaacttgcaagcagaagac agctggggctcctccaccccgctgaagttggccaccttgcggatgcagcc gccggcggggccctgcangttgcanttgccgccgccgttgcgcatgatgg ncctcatggaggtgancaggtgtccgtaggtcgtgcgcggctcgcactcg actgctttgatgaagc
Download
page-top