Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560244
Length 809 bp
Fasta Format > rwhkv11g13
aaaggtttttcaggtgacctaataatatgggcaggcaccacagctgccgc gattctcgtcactcgtcgcttctcgcggcggagagacgaggccaaaatta acatgacaaaagcatttacacaaacagggtacgaggaacccatatctgta ccgatacaactcgtacctccagagcagctgccaccatggtttcagtggct attgtacagttcaggacacactattatcttcttccatgttttctgatggt atctactatttgcggatattcaagttgagtgcagtatttagaagagcagc gtcaaatagaaaataatccatcccgtcatggagaacactgcaaaaatgtg cacccagaacaagatcgcggccgattctttcccgcaccctctcaagtttg caacggcacctgagagcacagatgtgggcatggaatgctgcagtagtaga acaaacttgaacattttgtcatctttgggaatgaaaccaagtttgtcaac tagcatgacgatgccaaccccagcaattggaaccaagatcaaccgtgcaa aaataatagcaacggtggtccgcacaccaagtcttttactcccttcacca ggaccatcaacaagattaccccccacagcaagcaaaatgcatggaatcat agcttccccaagaatgaggcagctgtctgtgaagaagaatagaggtgcat catccgtgaatatcaaacccttcaagaatggaacaacaccgattccaatt gcaaagacagaggcaataattggtggctgaagaaagttgcttgtctttta ggaatttca
Download
page-top