Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560150
Length 861 bp
Fasta Format > rwhkv11a11
gaagatacaagcagaagtacgtcgaagctaatacaaataaatgaccgatc ccgcgactcgacacaaaaacaatagcggctgtacgaaacatgggtaatct ctatcctatcccccaaccaaacctgaaatctcatccatcagaagaaactg cctggcacggttgcgcaatcagttccagaacacaggtgcagcggtgcgta ctcgtcgacatcgtgtaactgcagaagaatgaaaggaagggcctgacaga cgcagctctgcggcttcgacggtcttgcagttccctttcctacatttcca gctgcatcttgtaggctcctgagctctaaaggagacgagtacatgacaca atcacattcgcaaggaatggacgccgcccggagaaggcatgtcaactgca acaacttacagataaagcaaccgtgaggcagtgctgatggcaagaaaagc ctttattcacagacaacgggacagagctggaacaaacaccgtgttcctaa acctggcccgtctggtgctgatgagcaaactcgtcgaccccctgctagag tgacgtcgtgaaagagaactgtccagtttactcatttgtactatcaaagc tgtcgttcggtcgcttccgctctctggagttctccccccacattttagcg tccgcaatggcgcgctgcctgtcagcggtcctgggggtttctctcttcct tcctgtctgtgctgggctgcctgcctgtgatcctgccatgtccatttcat ccaatcctgacctccggccagaatcaccaccagtagaactantccggctg acctcccctccgtgctttgatgtcctangagaatgatgatttggtgagcg tccgttgcgct
Download
page-top