Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565412
Length 658 bp
Fasta Format > rwhkv9p04
ggaagagtacatggtacaagtacaataaagtctcggttctcctgaaaggc agtgaaagtaaaagcaaccatagtagtagtacaatagtggccggccatgc agagtagctcggcctacgcactcctttctccctcacatggagatcagatc agagcatttattcataagtattcgtgacctcagcatactcagcggccatg gatggcgctataggcggcagccattgtgggcagtggttgatcagcgaatc ttagagcagtcgacttttgagctgatggcataggggacgctcacgccgca cttggaggggatgccggcggccttgccagcgttgagcccgccggcagcac tcttgatgcacttgcaggccgcttgcttgtcagcggtgctccgggctgcg ccggccagactcctgacaccgctgcagcaggccgcagtcgggttggcgcc attgccgcgggcataggagatgcaggggctcaaggcggaggtcacctgac cgcaggagatggccgcgtccgtggctacnangancatcncggccaccatg gcgaccancacnanctgantanctgcancncnanccatcccnatcnantt tgcactantantgatgctganctcaactgganatgataangtggctanat ttgctaan
Download
page-top