Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565350
Length 830 bp
Fasta Format > rwhkv9l14
ctcacaaccaacaaataggtaaaatctgggctggaactttgcaaatacat gttgactagtacgcataatgcccatacccaaaatattaggacatccaact cctcggtaacttcataccacacaaaccgtttgccataccataccgcaaaa cccagcaattccagctccaaagtttttcatgtcctaagcaatctatgcaa caccacaactacaggccttaaaaagcggcattctcgcatctcaagatccg tcttacccacgaccacgtccgcctttgttgccacctttacttccaattcc gccccttccacggccaccgcctttgccatcatcttggccacgaccaatgc ctctgcctccaggtttagtgcctatatctcctcttcctcttccacgacca acacctggtggcttcctatctgatctactcttagaagtttcctcttgaac cttgtcaatcacctcatcaggaacccgaagatacttgatcgtgttaccac gaatatagcactccggcatcctccaaaacttatcaccatccttagaggtg caaataacctcccggaggtggatgttcatccacgtgtcgcagttcaccaa gtgcccattgtaggtctcgccgttcttgagctccacgagcatgggatgcc cctgggcggtcttgaggagcgagaggggaagcatcttgagcgagatccgg agattgaaaaaaagtccggatcggcggatggagacgccgagctggatcgc cgccggggcgggaaggaggcggcggctccgggggaagattgcgggagcaa aaccctaaatttggccgccgggtcgtgtcg
Download
page-top