Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565323
Length 536 bp
Fasta Format > rwhkv9j23
cgatacatgaacacacgattggtattggagagaaaaaaagatacatgaac acacggttcggacggagctgttcgaccgacgtcgtaccagcagccatggt aggagctcgtacgtagtagtagtacattacgtagtactagtagcaatagg cagcgtggcgctgcctagcacgccggcggcggtggaggcccggctactag cacttcggtacggcgacgccgcagctggtgagggtcttgcgggcgttggg gctgttgatgtagctggagtacgcggggttgcgcgcgtactggcagaagc acccccgctgactctttaggttgttgcagcacgtcgtcgacggcttggcc ccgctgatgatcggggaggcgcacaccgccaggctccccgcgttgcactg cgccgctccgcccgttgccatcgccgccaccactancgccaccagcacga gcatcgctgcggccttcgccatatggctcgactttcttttgatcgcaaac ggtacgtaccgcggtggtggaggtgggatgggagtg
Download
page-top