Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565087
Length 812 bp
Fasta Format > rwhkv8k12
atacggaatgatcagagtttacatataggatacaaatatgtttctttgca ctaactttttttccttagcatggccaactcaatatcaccatgtgttaaca tgccaaaacttctctcgggcttcgggcaccggtcatcatcatttgctact tctctttacatcggaactatggaggcgaataacacagaaccataacctaa acaaaacgctaggacaaagcacatttcagatgtttctggtaagggcataa ggctcctgtcatgccgccttattggtttggcttcagggcggcattcggcc ccagtccaagccatggctggttctcaaactccttcttgactggtgttgca tcagaaggagaagcttgatatggtgcctttgcatgcagacgatcctttct cttctcaaggaatcggtgaagtgacgcctttctagcaattggcagatcag aagcattcggacgagcagacttaggagcaacaaccggatcactaggcaaa ctacttgccggggccagcacggccgtctggaccttggcggtgtctgcagc agttgtggtcgcagagacgttctgagcaaccgggctgcccttgccagcca actgcatcaggcccttggccttgtcggctgggaaatcgttgaacacgagc accttcccaccatagaagatggtcagctggctcttgtcttcctccctagt agcgtcaggggcggcggcgtcctgcangccggcgctctgcgggaananct ccatggnctccttcttcctgccggcctcctcnncctccgccccangcnaa gggctcttggng
Download
page-top