Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ564983
Length 310 bp
Fasta Format > rwhkv8e04
ttttcgtagcacgatataaatattacaagcatgcacgcagcacgcgtaca aatttacattttacacccaccctcgcatatatacctctcgcacgctcacg tttcccacgacgacgggtaccatgcacaggacgacgatgctcggatcgga tcggatcgatttcgcctagtggaacttgaggctggtgaggatgttgttgt tgacggggtctgagaggtggtcgaggaggttctggaagggcccgacgccg gtgaagatggcctgcagggacatgccgaggaaggcgagcatggcgaggcg gccgttcttg
Download
page-top