Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ564573
Length 508 bp
Fasta Format > rwhkv6m09
ctccaactcagcgtcgcaaaaaggtacataaaccgaagattacaagagtg gtttcgagagcacaacaggaccctacaactcgactaaataaaataggtgg agagctctcttctcttctcttcactgggtggtggtggtggtgctgatgat gtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtact tgccgcaggctgttccaagatcaacattgtttccatggaaatggtgcacg ctaattttcgccaacatagcgtagtactcaatctctgacttcctcagggg cgggcagttgtttgcgaggattatcagcttccccttggagctgcgcagcg tcttgaggacggtcttgtagccgagcgtatacttgccgctcttcatcacc agctgcagcttgttgttgatgttctccccgctcttcttcgccttcttggt gggagccatcgcgtcgggcggccgcggcgagcgagcgtggggatgcggat ggcttcgg
Download
page-top