Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ564544
Length 835 bp
Fasta Format > rwhkv6k16
tttcgagactcaggaagaaagagcagtatgaggaactacacaacaaagaa tatgaaaagtgaaagtgacagagcgactaacagagcaaactgcacatcac tcagcagtttcagcgactcaaaatggaaaggataaatatatgaaatgaca ttaagaaacttagcactgactaccatacaacaagaccagtgtagagcgtc gcttcaatgtctaatgcttcttcccacttcccaggagcaacatgatcccg tcttgacgaacttgagaggcggcagaccaagagaatgccatgctcttagg cagatgccttgtcgaacttgaggggcttcaccacctcccaggtgaagtcg gcatcatcacggccaaagtgaccgtaagcagcggtcttgatgaacctgtt tccacctttcttcaagtccaggttgatgctgatcatcccgggcctgaagt caaagttctccttcacgagcttgaggatctccctgtcggggatcttgccg gtgccgtaggagtcgacgaacacagacaaaggctcaggcacaccgatggc gtatgagatctgcacaatgcagcggcgtgcgaggccgctggcgatgatgc tcttggcggcctgcctggcaatgtaggcgccactgcggtcgaccttggtt gggtccttgccagagaaggcaccgccgccgtgggctccccagccaccata ggtgtcgatgatgatcttgcggccggtgagaccggcgtcaccatgggggc cgccgatgacgaagcggccagacgggttcaggtggaanatggtgttctca tcnaggtactttgcggggatcaccggcttgatgac
Download
page-top