Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ564328
Length 785 bp
Fasta Format > rwhkv5o04
tagacagatctcgtccattgatgtattcgggggttgtgccgaagaagaag atatagacctatgaggaattacgtatgcatgctcaagaacctatgttcgt acatacatacacaaaatcatatagaacaaaaggtatgctccggtcagaaa gcagagtcgtacagcagagttttggacaaaagtgaagttcacaaaagacc ttcatacgagataggccattgtttcaactcgtagtttaggccttgccgga ctcctcgcaacccggtggcctaaaggcgatgaagctgacgcactgcacct ggcgcaggttgtcgaagccgatgacacggacataggcgtcagggtactcc ttcttgacctcctccacctcgttcagcacctgtgtggcgtcagtgcaccc gaacataggcagcttccacattgtccagtatcggccgtcgtagtacccgg gggagctgttgtgctcacggaagacgaagccaaccttgctgaactcgagg cagggcacccactttgagcggatcaggtagtcgacctgtttcaggagggc ctccgtggataggggtggcaggtaagacagggtctcgaacttcttgatgc cctcaattggccacacctgcatgcacctgatccttccgccattgctgacg ctgctgaggctgccgctggagcggcggccgacggggagaccggctgtgga cttgagcccctggaagggtgcgacggtggtanccgaggaagccatcacgg cggggggccatggtaatgtattatctggagganag
Download
page-top