Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ563952
Length 806 bp
Fasta Format > rwhkv4j04
cggccggggttaacaaaagagatattaccagatacaaaactcaacaaata cactgcccatagatagcagaatcgaaggattcaagcaggatcatacacac acacccatactagctaccactagctagcttcatatcaatttggtatagct agctactagtagttacacgacactgaagactcgcaccatgctatgatcgt caccggtactcacaggagagagatcatcacgctccccgatcgagaagtta caattgccaaaggatagaagttgccctaccttagtagaggtgagaagtcg ccgccgccgccgtggacgaggccgccctgccggccagccatggccgtttc accccgagcttcctcaagaacccaagtagcctagccagctgcagcttgat gtaggccagagatagctagccaacgccggatccatcggctgctacgtacg cgcccatgggccatggccggcccagggcacactccaagcctccaattgaa gaagagcacaggcatgcagctggtactggtagcttatgccaccaccatga cataagctatctgagatcttgtggcctacatggtgtgcgctgcgtgcacg gacgccggattggataacggagtgtgccctgcccggccctgccggccgta cgtgggcaggaccctcgtgccgaattcggcacgaggcgcatcatgccaac ataataagacagctgttttaccgacacgagaaagtttggtatattgcgac tacgattggtttgattgctcactggatcacagctaagttncacaatgtca gtctgg
Download
page-top