Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ563745
Length 519 bp
Fasta Format > rwhkv3o11
agctccaactcagcgtcgcaaaaaggtacataaaccgaagattacaagag tggtttcgagagcacaacaggaccctacaactcgactaaataaaataggt ggagagctctcttctcttctcttcactgggtggtggtggtggtgctgatg atgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagta cttgccgcaggctgttccaagatcaacattgtttccatggaaatggtgca cgctaattttcgccaacatagcgtagtactcaatctctgacttcctcagg ggcgggcagttgtttgcgaggattatcagcttccccttggagctgcgcag cgtcttgaggacggtcttgtagccgagcgtatacttgccgctcttcatca ccagctgcagcttgttgttgatgttctccccgctcttcttcgccttcttg gtgggagccatcgcgtcgggcggccgcggcgagcgagcgtggggatgcgg atggcttcgggggaggcgg
Download
page-top