Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ297827
Length 742 bp
Fasta Format > rwhsl22e07
aggggcacgacgaagccgttgttatttatttatttattgtgttgtacaca acgttgtttacatagcatcaagaagagcctgctgcatcatctccactcca ctccttcagcctccattgttgtgagtcgtcgtagatggcgactggtgact taggtgggagctcagttctcgtgatcccagacttcagatgcactcttgta cggcccatgggtcttgttcacgaacagctcctctccggtcagcacacgct tctcatctttgatgctgcacaggaccttgaagtcctcctcagggatctcc cacccgaacacctggatgttctccttgatcctctcgtctttgcttgactt gggaatcacactcgtccccctctgcagagcccacctgatgagcacctgcc ccggggtcttgttcagcttgttggccaccttttcgacaaccgggtcatga gcaaggttcttctctgaagaacccaatggtgagtaagcggtgacatggat cccgcgcttcttgcaggcctcgaacatcttgtcgttcttccaaccagggt gcatctccatctggcaaacggccggtggaatctttgcagaccgtagcagc cggtcgagcttggtcacggtgtagttgcagacgccgatgtccttaaccag tccgtccttgacaaggttctccatctccttccacaccccctccatgtcga attccagcacctcccctgcttccggaggcttgtgtgccccat
Download
page-top