Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ563245
Length 692 bp
Fasta Format > rwhkv2c24
attcggacataatatactctaagcaacaaagaacagatatcacaaatggg ggaaaggggagaaaaaaaatcacaatgtacgctgctgcaggtttcgtaga cagtggttctcagcagcatgggcggctaaccaaaggggcaacaattaatt tagataaactcctcccgtcttcatctacaaccaaaaaaatcccatctaac cccctccggtatttacacgaggggggcagatactcttgagcgccgatgat ccgatcagcagttgacgccgcactgccccatggcgacggccttctgggtg tcggatatgaacgggtcgatcttcacccacaggagggagaagatggaggc gaggaggatggaccagacgatgacgatggtcggcgtgcggttctgctttc ccatgagacccttgaggaaggggtagagatggaggatcacccagatcgag aagaagagctttccgaagagcgggccccaggattggtagccgctgttgat ggcgtatgatatgccggccaccatgcccacaaggttgatgaccaggacgg tggtcggagggatcaggagactggtccacttgaacacgtatagctcggcg aagtcgccgtcctcgtcgttcgccttggatgtgacagtgaanttggtgtc natcccggccancaccttgagcanaccctggaacaccncnaa
Download
page-top