Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560122
Length 846 bp
Fasta Format > rwhkv10n20
ttgttcaagagataccctagacaaagaaaacagaaaagaaacgaggaaac aatctgtacagggtgccgaaaggaagctagaacaaaggtctcagtctcag gggatgatgatcacgcatgatcaatcagcactgctctttctctaccgcct acaatgcaaaatgaagcgcaatgcaatgtcctacaggaaatgctcatgct atctctactaccctcggccggagccgagttctcggggacgccctcgttcg tcgacaccgatcttcatggctggaacctcgccgagggccccgagtcgccg ctcacctcgaactcgctcgagctcgccttggactcggcgtccgcgttgcc accggcatggccgcccctccggctcctccggtcctcccgtgatgggacat cctctgcctcaagcatccggacaacatggcccatagtgggtctcttctcg gagtccgggtcgacgcacctcagcgccactaggagggcgcgcttgagagc acggatggtcggctttacctccatgtcgcggtccaccacctcatcggctc tctttgtaccgaccatcattttgagccactccaccagatgcacctcattg gccggccgaccatagtcgacaggatccctcccagtaactgcttccagtan aagcacgccgaaactgtanacatcgctcttctcgtttaacagacctgtgt tggcatattcaggggccacatacccaaaggttcccataactcnagtcgtg atatggctcttcccancacccaacatcttggccaatccaaaatcanaaag cttcccattgaaatcctcatcaattangatattgcttgatttgata
Download
page-top