Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560097
Length 147 bp
Fasta Format > rwhkv10l22
atgattaactggtatgtagcctcattccggcaaaattttgtatgtaaata cacaacagagcctgcagtgcgacccaaaactatatacgggacaggtcgca tgttcattattccttccattccaagtatctataatattatctcagac
Download
page-top