Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ560035
Length 570 bp
Fasta Format > rwhkv10g20
acagcaccgttagtgcagtgcggccggctaattattatacatcacaagat ccatgaggcatgtcacgcattacatacatatgctaccacacgctccaaac cctgcaacatatatgtctgtcacacttctcccaagtgttcatcatcgatc tcgcctacactgcacgctgccggagcgcgggccggagctggctcagtcgc tgtcgctgtcgctgctgctgctgccgtggccgtcgtcgtccttgtggccc tcgccgtgcttcttgtccttcttcttcttcttgtccttcttctccttgtg gtcgccgtccttcttgccgtcgccgctgatcttgtccttgatcttctcca tcatgccctccttgtgctcgccgtccttcttgtgctccccgtccttcttc ttgtgctcctccgccttcttgtgctcctcgtccttcttgtgctcgtcgct gccgccgcccatgtggagcttctcctcgatcttgtgcatgatgccggcca tggcgctgctgtttctggctacttctctccaaggaaaatggcgatgctaa tgggatgcgatgatggtgtt
Download
page-top