Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559977
Length 663 bp
Fasta Format > rwhkv10c04
atatacggccggggttaacaaaagagatattaccagatacaaaactcaac aaatacactgcccatagatagcagaatcgaaggattcaagcaggatcata cacacacacccatactagctaccactagctagcttcatatcaatttggta tagctagctactagtagttacacgacactgaagactcgcaccatgctatg atcgtcaccggtactcacaggagagagatcatcacgctccccgatcgaga agttacaattgccaaaggatagaagttgccctaccttagtagaggtgaga agtcgccgccgccgccgtggacgaggccgccctgccggccagccatggcc gtttcaccccgagcttcctcaagaacccaagtagcctagccagctgcagc ttgatgtaggccagagatagctagccaacgccggatccatcggctgctac gtacgcgcccatgggccatggccggcccagggcacactccaagcctccaa ttgaagaagagcacaggcatgcagctggtactggtagcttatgccaccac catgacataagctatctgagatcttgtggcctacatggtgtgcgctgcgt gcacggacgccggattggataacggagtgtgccctgcccggccctgccgg ccgtacgtgggca
Download
page-top