Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ297726
Length 167 bp
Fasta Format > rwhsl21m20
atcgtcggcagaaccacnggcgatgacaacgacgaccacgaccactacta ccgttgaaacagcagcagagacacatgtaaccccgtactacatgtgtacg ttattcaaaccttcaacagagagaagcaaaggtgcgagctngcagcgcat gcctngccgccgcccnt
Download
page-top