Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ669307
Length 522 bp
Fasta Format > whkv18c17
gcaaagccagcgccgagcagcaagccccacacgccaattcggaatccttc tcctcccctccagccccgcgatcccgcccctcgccgcctgcccgatcggc ctgcttcctgccggggtctggtgggtgtacggaagagggcatttcttagt tgaggatgtacagttaatctgcagcagctcgaattgtancatttggttct tctgacatggctgaaggggcaaggtttcatggcatggttggcggtggcgg caaggggatgcaagagaacgagttcaatggcttcttcagcatgccctact atcanaaaattggggagggctcccacatgtctgtcgacagcactgacaac tacaacctcgccggtggctccgntaccatgtcagtggacaacagcancgt gggctcgaacgagtcccgtaccgtcatactaaagcacccgggcctccgtg atgccccaaccgcaagctattcggttggcaacagtgtctttcgtcccaac cgtgtggctgcgcacaccctaa
Download
page-top