Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ297683
Length 464 bp
Fasta Format > rwhsl21i24
tcgatcgagnatgcagcagctggctagtggcgacacggnatatacatacg acatacgtacgtataagggggcacacacacacacacacacattcaagtag gtacacagacgtatggctccatgggctagctagctgacgtacggcgaggg ccagctagccgtagcattccacatatgatcagcactgcctgatgcacttg caccggcggaggggcccgtcgcagttgccgccgccccagcgttcctgcag gcagacctgcgcgcagttcttgtccgacacgcatggccccttgaaccccg cgctgcgctgccggcagatcttcgcctccgcccccggcaccgccgcctcc tgtgcgatgaggaggagaagcaggaccaaaaccacctgcgtcgccacctt cttggtccacatggtgagcggccgggctgggagcgagctaaactctgctt gcgctacgtactgc
Download
page-top