Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ669045
Length 704 bp
Fasta Format > whkv17e04
gtacggccggcagggccgggcagggcacactccgttatccaatccggcgt ccgtgcacgcagcgcacaccatgtaggccacaagatctcagatagcttat gtcatggtggtggcataagctaccagtaccagctgcatgcctgtgctctt cttcaattggaggcttggagtgtgccctgggccggccatggcccatgggc gcgtacgtagcagccgatggatccggcgttggctagctatctctggccta catcaagctgcagctggctaggctacttgggttcttgaggaagctcgggg tgaaacggccatggctggccggcagggcggcctcgtccacggcggcggcg gcgacttctcacctctactaaggtagggcaacttctatcctttggcaatt gtaacttctcgatcggggagcgtgatgatctctctcctgtgagtaccggt gacgatcatagcatggtgcgagtcttcagtgtcgtgtaactactantanc tagctataccaaattgatatgaagctagctagtggtagctagtatgggtg tgtgtgtatgatcctgcttgaatccttcnattctgctatctatgggcagt gtatttgttganttttgtatctggtaatatctcttttgttaaccccngcc ntatattnactantgtaatcatcaataaatataatttgatatgtaaaaaa aaaa
Download
page-top